I miss those days, now it’s all boring version control
See also: Eurasian Brown Bear (Ursus arctos arctos)
Ursus is Latin for bear and arctos is Greek for…bear.
It’s the bear bear bear!
Bonus fun fact: Arctic means “the place with bears” and Antarctic means “the place without bears”
I think you have it the wrong way around. Ursus is Latin and arctos is Greek.
Oops! I really should be 💯 on it by now since it’s been one of my favorite facts for several years 😄
Anyways, thanks for the correction, I’ll go ahead and edit it 😁
“That one to left, that’s the most gorilla that can ever gorilla. Look how hard it’s gorillaing! Name it accordingly.”
OP missed a good opportunity to title this post “goriginallity”
Disgusted slow clap
deleted by creator
I mean, just look at 'em
10/10 gorilla
The most gorilla gorilla that ever gorillaed.
For a long time humans were classified as homo sapien sapien
Wait, they took one of our sapiens? The bastards!
Not that I’ve heard of. Now, whether Homo sapiens idaltu is a real separate species from Homo sapiens sapiens is disputed, so there’s a question as to whether the second sapiens actually differentiates us from anything… but I haven’t seen any signs of any consensus against calling ourselves Homo sapiens sapiens to date.
Maybe at some point we’ll have version control for all DNA mapping so each minor change is a commit hash and each major release is a tag
We do, the major versions have tag releases like mm7, mm8, mm9, etc. as defined by the current build, and minor patch releases too like mm10p14 as new sequences come in.
https://hgdownload.cse.ucsc.edu/goldenpath/mm10/bigZips/
Example, say you have 5 sequences: CAT, ATC, ATCG, CGT, and ATATA.
One way of combining them up together to build a transcriptome is like this:
5 sequences: ATATA CG-T ATC ATCG CAT Reference: ATCGATATATCATCGATATATC isn’t the only solution to these sequences, but as you get more sequences to try and overlap, the more the uncertainty goes down
That’s really interesting, thanks for sharing
some one tell him about Buffalo
gorilla together stronger
Cartoon Network Groovies (Gorilla 4 Sale) https://www.youtube.com/watch?v=r_oaVD4NzYo
It’s the gorillast of them all
Reminds me of my classification for different types of water when I was but a wee spud:
- “water-water” - flat water
- “water” - anything else
The guy who named it was running away from it in a panic at the time. “AH FUCK! GORILLA! GORILLA GORILLA GORILLA!”
